All pastesPublic feed

Public feed

Pastes people chose to make public. Author names hidden.
  • Untitled

    2067454·text·784 B·2011-05-23 09:51 UTC
    Connecting to login on 127.0.0.1:9014
    Disconnected from Login, Trying to reconnect: Connection refused: connect
    java.net.ConnectException: Connection refused: connect
     at java.net.PlainSocke
  • Miscellany

    2067453·text·16.3 KB·2011-05-23 09:50 UTC
    <DNA>TCTGCCCCCTTCCAGCTTCTCACGTTCTCACTATGTCTGCTCCAGACGAAGGGAGACGGGATCCCCCCAAACCGAAGGGCAAGGTAAAGAGGGGAAATGGGGCAGATTCTTGCTGGGGCCTGGAGATGCCCCAGAGCCGGGGAAGGTGACCTCCACAGTCCTGGGGTCTCGAATCTGGAGAGGTGCTTCCCTGGT
  • Anonymous

    2067449·text·6.6 KB·2011-05-23 09:45 UTC
    fixme:ole:OleLoadPictureEx (0xb206e4,6470,0,{7bf80980-bf32-101a-8bbb-00aa00300cab},x=0,y=0,f=0,0x32fa70), partially implemented.
    fixme:ole:OleLoadPictureEx (0xb206e4,3966,1,{7bf80980-bf32-101a-8bbb-0
  • Anonymous

    2067447·text·5.7 KB·2011-05-23 09:43 UTC
    # ---------------------------------------------------------------------------
    # Rate Settings
    # ---------------------------------------------------------------------------
    # The defaults are set to
  • Stuff

    2067437·text·1008 B·2011-05-23 09:30 UTC
    %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
    % IRI Template
    \documentclass[xcolor=dvipsnames,hyperref={pdfpagelabels=false}, table, 14pt]{beamer} % [compress]
    \usethe
  • Untitled

    2067435·text·16.9 KB·2011-05-23 09:30 UTC
    Exception reported from <CENSORED!>
    Time: Mon May 23 11:25:58 2011
    Exception type <CENSORED!>.server.rhnSQL.sql_base.SQLError
    Exception while handling function queue.get
    Request object information
  • Stuff

    2067431·text·720 B·2011-05-23 09:27 UTC
    export GNUINE_HOME=$HOME/projects/
    
    function cs {
     local dest current
     
     if test -n "$1"; then
     cd "$GNUINE_HOME/$1"
     fi
    }
    function _cs_scandir
    {
  • Unnamed

    2067425·text·677 B·2011-05-23 09:08 UTC
    Lost!
    _____
    
    Personal
    --
    
    Name: Rodney "Punch" Futz
    Size: Brute
    Personality: Brute
    Age: Thirty-brute
    Intelligence: Brutish
    
    Talents
    --
    
    Accuracy: 1
    Athletics: 2
    Brawling: 3 - Punchi
  • Anonymous

    2067423·text·746 B·2011-05-23 09:07 UTC
    Starting L2J Game Server.
    
    Loading GameServer Configuration Files...
    L2Properties: Missing property for key - DatapackRoot
    java.lang.NumberFormatException: empty String
     at sun.misc.Floati
  • Untitled

    2067407·text·944 B·2011-05-23 08:50 UTC
    /home/hell/files/arch/quodlibet/quodlibet-hg/quodlibet/quodlibet/qltk/songlist.py:346: G
    tkWarning: gtk_list_store_get_value: assertion `VALID_ITER (iter, list_store)' failed
     value = model[iter][0
  • Mine

    2067406·text·857 B·2011-05-23 08:47 UTC
    *=$5800
    .binary "War_and_Pace.prg",2
    
    *=$1000
    
    jsr $5800
    jsr $e544
    
    sei ; turn off interrupts
    lda #$7f
    ldx #$01
    sta $dc0d ; Turn off CIA 1 interrupts
    sta $dd0d ; Turn off CI
  • hillbicks

    2067397·text·8.9 KB·2011-05-23 08:24 UTC
    !!################################
    !!ALSA Information Script v 0.4.60
    !!################################
    
    !!Script ran on: Mon May 23 08:24:16 UTC 2011
    
    !!Linux Distribution
    !!------------------
    
    Ub
  • Untitled

    2067382·text·82.2 KB·2011-05-23 08:02 UTC
    
        
  • Mine

    2067376·text·614 B·2011-05-23 07:51 UTC
    Everything is now working.
    Got hold-down press right click to work. I also managed to install Florence and get an on-screen keyboard for login and lock screen. You have to disable focus grab and d
  • Miscellany

    2067372·python·809 B·2011-05-23 07:48 UTC
    from sqlalchemy import *
    from sqlalchemy.orm import sessionmaker, relation, eagerload, scoped_session
    from sqlalchemy.ext.declarative import declarative_base
    import datetime
    engine = create_engine
  • Something

    2067371·text·430 B·2011-05-23 07:48 UTC
    221341] hdpvr: Unknown symbol v4l2_device_register (err -22)
    [ 9615.221856] hdpvr: Unknown symbol __video_register_device (err 0)
    [ 9615.222730] hdpvr: disagrees about version of symbol v4l2_device_
  • Something

    2067367·text·1.6 KB·2011-05-23 07:42 UTC
    # Create your views here.
    from django.http import HttpResponse, HttpResponseRedirect
    from django.core import serializers
    from django.utils import simplejson as json
    from django.contrib.auth.models
  • Miscellany

    2067343·text·1.2 KB·2011-05-23 07:06 UTC
    echosyp@echosyp:~/media_build$ make
    make -C /home/echosyp/media_build/v4l 
    make[1]: Entering directory `/home/echosyp/media_build/v4l'
    creating symbolic links...
    make -C firmware prep
    make[2]: En
  • Untitled

    2067342·text·12.1 KB·2011-05-23 07:05 UTC
    CONFIG_VIDEO_GO7007=n
    CONFIG_VIDEO_TM6000_ALSA=n
    CONFIG_MEDIA_TUNER_TDA18271=n
    CONFIG_IR_MCEUSB=n
    CONFIG_LIRC_ZILOG=n
    CONFIG_USB_DSBR=n
    CONFIG_VIDEO_CX88_VP3054=n
    CONFIG_SOC_CAMERA_OV6650=n
    CO
  • Miscellany

    2067339·text·1.2 KB·2011-05-23 07:03 UTC
    echosyp@echosyp:~/media_build$ sudo make install
    make -C /home/echosyp/media_build/v4l install
    make[1]: Entering directory `/home/echosyp/media_build/v4l'
    
    Removing obsolete files from /lib/module

older pastes →