-
2067454·text·784 B·2011-05-23 09:51 UTC
Connecting to login on 127.0.0.1:9014
Disconnected from Login, Trying to reconnect: Connection refused: connect
java.net.ConnectException: Connection refused: connect
at java.net.PlainSocke
-
2067453·text·16.3 KB·2011-05-23 09:50 UTC
<DNA>TCTGCCCCCTTCCAGCTTCTCACGTTCTCACTATGTCTGCTCCAGACGAAGGGAGACGGGATCCCCCCAAACCGAAGGGCAAGGTAAAGAGGGGAAATGGGGCAGATTCTTGCTGGGGCCTGGAGATGCCCCAGAGCCGGGGAAGGTGACCTCCACAGTCCTGGGGTCTCGAATCTGGAGAGGTGCTTCCCTGGT
-
2067449·text·6.6 KB·2011-05-23 09:45 UTC
fixme:ole:OleLoadPictureEx (0xb206e4,6470,0,{7bf80980-bf32-101a-8bbb-00aa00300cab},x=0,y=0,f=0,0x32fa70), partially implemented.
fixme:ole:OleLoadPictureEx (0xb206e4,3966,1,{7bf80980-bf32-101a-8bbb-0
-
2067447·text·5.7 KB·2011-05-23 09:43 UTC
# ---------------------------------------------------------------------------
# Rate Settings
# ---------------------------------------------------------------------------
# The defaults are set to
-
2067437·text·1008 B·2011-05-23 09:30 UTC
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
% IRI Template
\documentclass[xcolor=dvipsnames,hyperref={pdfpagelabels=false}, table, 14pt]{beamer} % [compress]
\usethe
-
2067435·text·16.9 KB·2011-05-23 09:30 UTC
Exception reported from <CENSORED!>
Time: Mon May 23 11:25:58 2011
Exception type <CENSORED!>.server.rhnSQL.sql_base.SQLError
Exception while handling function queue.get
Request object information
-
2067431·text·720 B·2011-05-23 09:27 UTC
export GNUINE_HOME=$HOME/projects/
function cs {
local dest current
if test -n "$1"; then
cd "$GNUINE_HOME/$1"
fi
}
function _cs_scandir
{
-
2067425·text·677 B·2011-05-23 09:08 UTC
Lost!
_____
Personal
--
Name: Rodney "Punch" Futz
Size: Brute
Personality: Brute
Age: Thirty-brute
Intelligence: Brutish
Talents
--
Accuracy: 1
Athletics: 2
Brawling: 3 - Punchi
-
2067423·text·746 B·2011-05-23 09:07 UTC
Starting L2J Game Server.
Loading GameServer Configuration Files...
L2Properties: Missing property for key - DatapackRoot
java.lang.NumberFormatException: empty String
at sun.misc.Floati
-
2067407·text·944 B·2011-05-23 08:50 UTC
/home/hell/files/arch/quodlibet/quodlibet-hg/quodlibet/quodlibet/qltk/songlist.py:346: G
tkWarning: gtk_list_store_get_value: assertion `VALID_ITER (iter, list_store)' failed
value = model[iter][0
-
2067406·text·857 B·2011-05-23 08:47 UTC
*=$5800
.binary "War_and_Pace.prg",2
*=$1000
jsr $5800
jsr $e544
sei ; turn off interrupts
lda #$7f
ldx #$01
sta $dc0d ; Turn off CIA 1 interrupts
sta $dd0d ; Turn off CI
-
2067397·text·8.9 KB·2011-05-23 08:24 UTC
!!################################
!!ALSA Information Script v 0.4.60
!!################################
!!Script ran on: Mon May 23 08:24:16 UTC 2011
!!Linux Distribution
!!------------------
Ub
-
2067382·text·82.2 KB·2011-05-23 08:02 UTC
-
2067376·text·614 B·2011-05-23 07:51 UTC
Everything is now working.
Got hold-down press right click to work. I also managed to install Florence and get an on-screen keyboard for login and lock screen. You have to disable focus grab and d
-
2067372·python·809 B·2011-05-23 07:48 UTC
from sqlalchemy import *
from sqlalchemy.orm import sessionmaker, relation, eagerload, scoped_session
from sqlalchemy.ext.declarative import declarative_base
import datetime
engine = create_engine
-
2067371·text·430 B·2011-05-23 07:48 UTC
221341] hdpvr: Unknown symbol v4l2_device_register (err -22)
[ 9615.221856] hdpvr: Unknown symbol __video_register_device (err 0)
[ 9615.222730] hdpvr: disagrees about version of symbol v4l2_device_
-
2067367·text·1.6 KB·2011-05-23 07:42 UTC
# Create your views here.
from django.http import HttpResponse, HttpResponseRedirect
from django.core import serializers
from django.utils import simplejson as json
from django.contrib.auth.models
-
2067343·text·1.2 KB·2011-05-23 07:06 UTC
echosyp@echosyp:~/media_build$ make
make -C /home/echosyp/media_build/v4l
make[1]: Entering directory `/home/echosyp/media_build/v4l'
creating symbolic links...
make -C firmware prep
make[2]: En
-
2067342·text·12.1 KB·2011-05-23 07:05 UTC
CONFIG_VIDEO_GO7007=n
CONFIG_VIDEO_TM6000_ALSA=n
CONFIG_MEDIA_TUNER_TDA18271=n
CONFIG_IR_MCEUSB=n
CONFIG_LIRC_ZILOG=n
CONFIG_USB_DSBR=n
CONFIG_VIDEO_CX88_VP3054=n
CONFIG_SOC_CAMERA_OV6650=n
CO
-
2067339·text·1.2 KB·2011-05-23 07:03 UTC
echosyp@echosyp:~/media_build$ sudo make install
make -C /home/echosyp/media_build/v4l install
make[1]: Entering directory `/home/echosyp/media_build/v4l'
Removing obsolete files from /lib/module