-
2080963·text·413 B·2011-09-19 03:39 UTC
Intel i7-2600K 320
AsRock ASRock Z68 Extreme4 179
8G (4Gx2) 2133 Patriot Viper-Xtreme 2 97
OCZ Solid 3 120GB 189
WD Green 2TB
-
2080962·text·262 B·2011-09-19 03:38 UTC
Intel i7-2600K 320
AsRock ASRock Z68 Extreme4 179
8G (4Gx2) 2133 Patriot Viper-Xtreme Div.2 2 97
OCZ Solid 3 120GB 189
WD Green 2TB 83
CoolerMaster HAF 922 125
Antec HCG-
-
2080961·text·388.0 KB·2011-09-19 03:38 UTC
-
2080939·text·348 B·2011-09-19 02:06 UTC
/cygdrive/e/libre/libreoffice-bootstrap-3.4.3.2/solver/340/wntmsci12.pro/workdir
/Dep/LinkTarget/Library/isw.lib.d:111732: *** multiple target patterns. Stop.
the offending line in isw.lib.d is
-
2080935·text·874 B·2011-09-19 01:57 UTC
$ORIGIN sydunco.com.au.
$TTL 3600
@ IN SOA ns1.softlayer.com. root.sydunco.com.au. (
2011041204 ; Serial
3600 ; Refresh
-
2080934·text·420 B·2011-09-19 01:44 UTC
Blitchiz TvT
10 depot
12 rax
13 gas
15 orbital
16 marine
16 depot
18 factory
20 second gas
23 Starport
24 Reactor on Barracks
Tech lab on starport when it completes
Make hellions fro
-
2080931·text·2.8 KB·2011-09-19 01:09 UTC
/*****************************************************
*
* TwoCube.c
*
* Jason Ng 100383886
*
* Question 1b - Assignment 1
* Displays 2 cubes rotating in opposite di
-
2080923·text·130 B·2011-09-19 00:54 UTC
Please don't neglect "-" when grouping packages in Linkgrabber. It is very annoying and this only happens in your newest version.
-
2080915·text·680 B·2011-09-18 23:52 UTC
if ( isset($start) ) {
$params[':time_range_start'] = $start;
$start_sql .= ' ((dtend IS NULL AND dtstart > :time_range_start) OR dtend > :time_range_start) ';
}
-
2080912·text·682 B·2011-09-18 23:34 UTC
if ( isset($start) ) {
$params[':time_range_start'] = $start;
$start_sql .= ' ((dtend IS NULL AND dtstart > :time_range_start) OR dtend > :time_range_start) ';
}
-
2080911·text·681 B·2011-09-18 23:26 UTC
if ( isset($start) ) {
$params[':time_range_start'] = $start;
$start_sql .= ' ((dtend IS NULL AND dtstart > :time_range_start) OR dtend > :time_range_start) ';
}
-
2080910·text·684 B·2011-09-18 23:23 UTC
if ( isset($start) ) {
$params[':time_range_start'] = $start;
$start_sql .= ' (dtend IS NULL AND dtstart > :time_range_start) OR dtend > :time_range_start) ';
}
-
2080907·text·1.7 KB·2011-09-18 23:13 UTC
# This version crashes.
package require Tclsdl
set screen [sdl::surface -width 640 -height 480 -bpp 32]
vwait forever
# This version does not crash.
package require Tclsdl
package require Tk
-
2080896·text·427 B·2011-09-18 22:42 UTC
# This version crashes.
package require Tclsdl
set screen [sdl::surface -width 640 -height 480 -bpp 32]
vwait forever
# This version does not crash.
package require Tclsdl
package require Tk
-
2080895·text·10 B·2011-09-18 22:42 UTC
:) the gam
-
2080891·text·1.3 KB·2011-09-18 22:07 UTC
>DinoDNA "Dinosaur DNA" from Crichton JURASSIC PARK p. 103 nt 1-1200
GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG
TGTT
-
2080890·text·894 B·2011-09-18 21:55 UTC
1>------ Build started: Project: Hello World, Configuration: Debug Win32 ------
1>Build started 18/09/2011 22:55:25.
1>InitializeBuildStatus:
1> Touching "Debug\Hello World.unsuccessfulbuild".
1>
-
2080889·text·102.1 KB·2011-09-18 21:54 UTC
-
2080877·text·785 B·2011-09-18 21:06 UTC
[22:45:42] <Skulduggery> http://en.wikipedia.org/wiki/The_Shakespeare_Code
[22:45:56] <Skulduggery> http://en.wikipedia.org/wiki/42_(Doctor_Who)
[22:45:59] <Skulduggery> http://en.wikipedia.org/w
-
2080873·text·13.6 KB·2011-09-18 21:00 UTC
Version: 3347
Game Lobby
WoL
roa|0 credits|Rules|Guide|Forum|Report Bug|Log Out
Throne
Kingdom
News
Explore
Growth
Sciences
Military
Wizards